How to sequence the human genome – Mark J. Kiel

How to sequence the human genome – Mark J. Kiel


You’ve probably heard of the human genome, the huge collection of genes inside each and every one of your cells. You probably also know that we’ve sequenced the human genome, but what does that actually mean? How do you sequence someone’s genome? Let’s back up a bit. What is a genome? Well, a genome is all the genes plus some extra that make up an organism. Genes are made up of DNA, and DNA is made up of long, paired strands of A’s, T’s, C’s, and G’s. Your genome is the code that your cells use to know how to behave. Cells interacting together make tissues. Tissues cooperating with each other make organs. Organs cooperating with each other make an organism, you! So, you are who you are in large part because of your genome. The first human genome was sequenced ten years ago and was no easy task. It took two decades to complete, required the effort of hundreds of scientists across dozens of countries, and cost over three billion dollars. But some day very soon, it will be possible to know the sequence of letters that make up your own personal genome all in a matter of minutes and for less than the cost of a pretty nice birthday present. How is that possible? Let’s take a closer look. Knowing the sequence of the billions of letters that make up your genome is the goal of genome sequencing. A genome is both really, really big and very, very small. The individual letters of DNA, the A’s, T’s, G’s, and C’s, are only eight or ten atoms wide, and they’re all packed together into a clump, like a ball of yarn. So, to get all that information out of that tiny space, scientists first have to break the long string of DNA down into smaller pieces. Each of these pieces is then separated in space and sequenced individually, but how? It’s helpful to remember that DNA binds to other DNA if the sequences are the exact opposite of each other. A’s bind to T’s, and T’s bind to A’s. G’s bind to C’s, and C’s to G’s. If the A-T-G-C sequence of two pieces of DNA are exact opposites, they stick together. Because the genome pieces are so very small, we need some way to increase the signal we can detect from each of the individual letters. In the most common method, scientists use enzymes to make thousands of copies of each genome piece. So, we now have thousands of replicas of each of the genome pieces, all with the same sequence of A’s, T’s, G’s, and C’s. But we have to read them all somehow. To do this, we need to make a batch of special letters, each with a distinct color. A mixture of these special colored letters and enzymes are then added to the genome we’re trying to read. At each spot on the genome, one of the special letters binds to its opposite letter, so we now have a double-stranded piece of DNA with a colorful spot at each letter. Scientists then take pictures of each snippet of genome. Seeing the order of the colors allows us to read the sequence. The sequences of each of these millions of pieces of DNA are stitched together using computer programs to create a complete sequence of the entire genome. This isn’t the only way to read the letter sequences of pieces of DNA, but it’s one of the most common. Of course, just reading the letters in the genome doesn’t tell us much. It’s kind of like looking through a book written in a language you don’t speak. You can recognize all the letters but still have no idea what’s going on. So, the next step is to decipher what the sequence means, how your genome and my genome are different. Interpreting the genes of the genome is the part scientists are still working on. While not every difference is consequential, the sum of these differences is responsible for differences in how we look, what we like, how we act, and even how likely we are to get sick or respond to specific medicines. Better understanding of how disparities between our genomes account for these differences is sure to change the way we think not only about how doctors treat their patients, but also how we treat each other.

99 thoughts on “How to sequence the human genome – Mark J. Kiel

  1. This video is already 3 years old..

    My last birthday gifts:
    2 Tea cups.
    1 Deodorant.
    1 Picture frame.
    10 Euros.
    1 burned dvd with downloaded movies.
    0 GENOME SEQUENCERS

  2. Hi, I have a question. Soat min 3.39 the narrator says that the pieces of DNA are stitched together. I'm assuming that this is done by the overlapping ends.. But could there not be errors where the ends might be overlapping but the mid parts are different? Wouldnt that cause wrong pieces to be stiched? Thanks. Newbie student

  3. hope that there are more info on application of molecular biology can be made into animation like this for better understanding

  4. weve come a long way since then…and now we have our very own word processor for genes called CRISPR CAS9.

  5. all the genes that make up an organism…(plus some extra)… what's this supposed to mean?… someone please explain…

  6. I recently had a project about the history of genetics and the genome sequencing was the hardest part for me to understand
    so thank you for this videos ♡

  7. Will blockchain technology be created to track genomes so that globally we can share data and understand the mathematical connections between dna?

  8. I don't think this project actually took over two decades to complete. In fact, the HGP was completed two years ahead of their original 15-year goal in 2003.

  9. Human life, animal life, and plant life was created by God(Father,Jesus,Holy Spirit) according to the bible.

  10. Very cool! I've learned at school that Brazil cooperated to the Genoma Project you mention at minute 1:16 in this video. You've hightlighted on the Earth globe, US, some contries at Europe and Asia, but not Brazil. Don't you think, or don't you know, Brazil made a relevant work on this international efforce to decode the human being DNA?

  11. I promise you I will forget this tomorrow. I like learning about these things but I will have to watch it around 7 times before I can remember it. There's just so much information. Good job.

  12. gattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattacagattaca

  13. To the people saying it's too simple, chill tf out, honestly, Ted-Ed wants to teach us something simple, not go to the depths of genetics. Us mere mortals require simplified versions of things like these so if you don't like it, leave. You don't have to sh?t on a great video that probably took ages to make.

  14. 2000: Finally we finished this multi-billion dollar international effort to map the human genome.

    2019: just spit here, I'll tell you every letter in your genome for a 1000 bucks

  15. FIRST MATTER: In every facet of the motion of all particles the light of Divine unity shines like the sun. For as is proved briefly in the First Indication of the Tenth Word and in detail in the Twenty-Second Word, if every particle is not an official of God acting with His permission and under His authority, and if it is not undergoing change within His knowledge and power, then every particle must have infinite knowledge and limitless power; it must have eyes that see everything, a face that looks to all things, and authority over all things. For every particle of the elements acts, or can act, in an orderly fashion in all animate beings. But the order within things and laws according to which they are formed differ from one thing to the next. If their order was not known to the particles, the particles could not act, or even if they could act, they could not act without error. In which case, the particles which are performing their duties in beings are either acting with the permission and at the command, and within the knowledge and at the will, of the owner of an all-encompassing knowledge, or they themselves must have such an all-encompassing knowledge and power. Yes, all particles of air can enter the bodies of all animate beings, the fruits of all flowers, and the structures of all leaves. They can act within them, although the way the beings are formed is all different and their order and systems quite distinct. As though the factory of a fig was a loom for weaving cloth and the factory of a pomegranate, a machine for producing sugar, and so on; the programmes of their structures and bodies all differ from each other. A particle of air, then, enters or can enter all of them. It takes up its position and acts in a wise and masterly fashion without error. And on completion of its duty it departs. A mobile particle of mobile air, therefore, either must know the forms, shapes, measures, and formations with which plants and animals, and even fruits and flowers, are clothed, or else it must be an official acting under the command and will of one who does know. Similarly with a stationary particle of stationary earth: since it has the ability to be the means and place of cultivation for all the seeds of all flowering plants and fruit-bearing trees, either there must be in the particle itself or in the handful of soil that is its little house immaterial machinery and factories in good working order to the number of the varieties of the trees and plants, and flowers and fruits in fact, it is in every single particle that there must be a factory peculiar to it and all the equipment and machinery necessary for the running of the factory or else it must have a miraculous knowledge that knows all things about all things and a miracle-working power that creates everything from nothing; or, those duties are performed at the command and with the permission of One Who is Knowing of All Things, and through the power and might of One Who is Absolutely Powerful over All Things. If an untrained and inexperienced, common, ordinary, and blind man was to go to Europe and in all the factories there to work at all the trades and crafts in perfect and masterly fashion, and if he was to display a wise and artistic skill to such a degree that it left everyone speechless with amazement, anyone with a grain of consciousness would know that the man was not acting on his own initiative, but that a master of all trades was teaching him and causing him to work. And if there was a blind and impotent man who lived in a simple little house and was unable even to rise from his place, and if small fragments of stone, and bits and pieces of material like bone and cotton were to enter his little house and then sacks of sugar, bales of cloth, crates of jewelry, finely-made clothes encrusted with jewels, and delicious foods were to emerge, would anyone with a grain of intelligence not say: "That man is a wretched doorkeeper or merely a latch on the door of the factory of a wondrous miracle-working being, which is the source of his miracles"? In exactly the same way, the motion and duties of particles of air in plants and trees, and blossom and fruit, all of which are missives of the Eternally Besought One, antique dominical works of art, miracles of power, and wonders of wisdom, indicate that the particles are acting under the command and at the will of an All-Wise and Glorious Maker, an All-Generous and Beauteous Creator. Particles of earth, also, since they are the source and means for the shoots and plants produced by seeds, each of which is a different factory and workbench, a different printing-press, treasury, and antique, a different manifesto proclaiming the Glorious Maker's Names and ode hymning His perfections, it is as definite as two plus two equalling four that the particles of earth are acting at the command, with the permission, and through the will and power of an All-Glorious Maker Who is Lord of the command of "Be!" and it is, {[*]: Qur'an, 36:82, etc.} and to Whose command everything is subjugated. In this we believe. Risale-i Nur Collection 572 – Bediüzzaman Said Nursi

  16. Video ID / sCPNMvuYATh7Y74 / XC1R VYY8 RT28
    Viewport / Frames966x543*2.00 / 0 dropped of 980
    Current / Optimal [email protected] / 1920×[email protected]
    Volume / Normalized100% / 100% (content loudness -3.7dB)
    Codecsavc1.640028 (137) / mp4a.40.2 (140)
    Connection Speed4040 Kbps
    Network Activity112 KB
    Buffer Health40.95 s
    Mystery Text

  17. 📲*00212.645.75.23.01* *whatapps*📲
    وجـدت💁‍♂️ كــثــيــر مــن الـكـومـنـتـات عــن تـكـبـيـر الــقــضــيــب وضــعــف الانـتـصـاب وسـرعـة الـقـذف
    وأبـغـى أبــشــركــم😉 أنــي حـصـلـت عـلـى مــعــلــومــات كــثــيــر مـفـيـدة✅ هـتـنـفـعـكـم كـثـيـر ومـجـربـهـا كـمـان ونـفـعـتـنـي🤩🥳
    تــواصــل مـعـي🙋‍♂️ وأنـا بــشــرح لــك ســر الــوصــفــة الـواتـس اب *00212645752301*📲

  18. Do you realise "DOUBLE LOGIC" is in the structure of the human GENOME…. This affects everything that takes place in your body, including human evaluation, and reason and decision making.

Leave a Reply

Your email address will not be published. Required fields are marked *